Advanced Search



MISSION® Lenti microRNA Inhibitor, Human

SIGMA/HLTUD0895 - hsa-miR-663a

Synonym: hsa-miR-663; Tough Decoy; TuD

Product Type: Chemical

Catalog Number PKG Qty. Price Quantity
45-HLTUD0895 1 pkg
$0.00
1/EA
CALL FOR PRICE
Add To Favorites
This image is provided for informative purposes only and does not represent an actual product label. It should not be used as a substitute for official product labeling.

 

concentration ≥1x106 VP/ml (via p24 assay)
form liquid
mature sequence AGGCGGGGCGCCGCGGGACCGC
product line MISSION®
Sanger mature/minor accession no. MIMAT0003326 
Sanger microRNA accession no. MI0003672 
shipped in dry ice
storage temp. −70°C
technique(s) capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
General description: Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

• Allows for potent inhibition of the desired miRNA
• Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
• Enables long-term inhibition without repeat transfection
Legal Information: MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Other Notes: Based on miRBase V19 Mature ID
RIDADR UN 3245 9
WGK Germany WGK 3
Flash Point(F) Not applicable
Flash Point(C) Not applicable
Storage Temp. −70°C
UNSPSC 41106609

The following items have been added to your cart:

Choose a favorite list for this item:

Catalog Number Description Price
$

Returns/Order support

Please fill out the form below if you want to request order support from Krackeler Scientific.


Quick Order

* Required


New Year Price Updates

We are currently working diligently to update our website pricing information for the New Year. If you place an order, you will be acknowledged with any corrected pricing. If you'd like the most current information sooner, please don't hesitate to drop us an email or give us a call and we'd be happy to assist. Thank you for your patience while we are updating.

800-334-7725
office@krackeler.com


Play Video

To Request a Quote

  1. Search or Browse for items and add to them to your Shopping Cart.
  2. Click the "Request Quote" button at the bottom of the Shopping Cart page.
  3. Fill out required fields.
  4. Optionally you can convert to standard checkout mode by choosing a payment type.
  5. Click "Request Quote" at the bottom of the page.

You will be contacted with a quote.

To Order From a Quote

  1. Register and login to the website.
  2. Receive a quote from your sales representative or customer service.
  3. Have your copy of the quote in hand.
  4. Visit our quote module to search for your quote.
Back to Top