MISSION® Lenti microRNA Inhibitor, Human
SIGMA/HLTUD0895 - hsa-miR-663a
Synonym: hsa-miR-663; Tough Decoy; TuD
Product Type: Chemical
| concentration | ≥1x106 VP/ml (via p24 assay) |
| form | liquid |
| mature sequence | AGGCGGGGCGCCGCGGGACCGC |
| product line | MISSION® |
| Sanger mature/minor accession no. | MIMAT0003326 ![]() |
| Sanger microRNA accession no. | MI0003672 ![]() |
| shipped in | dry ice |
| storage temp. | −70°C |
| technique(s) | capture ELISA: 106 TU/mL using p24 (Volume 200 uL) |
| General description: | Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. • Allows for potent inhibition of the desired miRNA • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types • Enables long-term inhibition without repeat transfection |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| Other Notes: | Based on miRBase V19 Mature ID |
| RIDADR | UN 3245 9 |
| WGK Germany | WGK 3 |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −70°C |
| UNSPSC | 41106609 |

